Display Settings:

Format

Send to:

Choose Destination
Pr012496956

STS probe SHGC-36196 for SHC adaptor protein 3 (SHC3) and 4 more genes

Synopsis

Field NameValues
NameSHGC-36196
AliasRH37880
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSHC3; SHC3; SHC3; SHC3; SHC3
UniSTS IDUniSTS:25981

Sequences

>Probe|12496956|PRIMERF Forward PCR primer (outermost) (25b)
CAGCACAGAACATTAGTCTTACATC
>Probe|12496956|PRIMERR Reverse PCR primer (outermost) (25b)
ACTTGGTTCTGAATTTCTCATATGC

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G392973 cr10000SHGC-36196
Homo sapiensradiation hybridGeneMap99-G392871 cr10000SHGC-36196
Homo sapienslinkageRutgers Map9 cmSHGC-36196
Homo sapiensradiation hybridNCBI RH9757.5 crSHGC-36196

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID25981
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center