Display Settings:

Format

Send to:

Choose Destination
Pr012494465

STS probe px-30g2

Synopsis

Field NameValues
Namepx-30g2
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:257568

Sequences

>Probe|12494465|PRIMERF Forward PCR primer (outermost) (21b)
GTTTTTGATCTTAGCCATTCT
>Probe|12494465|PRIMERR Reverse PCR primer (outermost) (21b)
ATAAAGAACTCAAGAAGGTGG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID257568
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center