Display Settings:

Format

Send to:

Choose Destination
Pr012493712

STS probe D3S3716 for uncharacterized LOC100584912 (LOC100584912)

Synopsis

Field NameValues
NameD3S3716
AliasesA065XF5; AFMA065XF5; AFMa065xf5; HSA065XF5; RH30821; SHGC-20128; W5159
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneLOC100584912
UniSTS IDUniSTS:25689

Sequences

>Probe|12493712|PRIMERF Forward PCR primer (outermost) (19b)
CAGAGCCCAGCATATAGGT
>Probe|12493712|PRIMERR Reverse PCR primer (outermost) (22b)
CCAATGACACAGGAGTTTATTC

References

1.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

2.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

Show All 3 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-G334324 cr10000AFMa065xf5
Homo sapienslinkageRutgers Map3 cmD3S3716
Homo sapienslinkageMarshfield3115.76 cmAFMa065xf5
Homo sapienslinkageGenethon3115.8 cmAFMa065xf5

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID25689
Probe Cross-refcontext specific help for: Probe Cross-refGDB:614220
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center