Display Settings:

Format

Send to:

Choose Destination
Pr012487864

STS probe UniSTS:251621 for calpain 3 (CAPN3) and 8 more genes

Synopsis

Field NameValues
NameUniSTS:251621
AliasesSKM-CALPOV; CANP3; CANP3S4; CAPN3; CAPN3_S
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCAPN3; CAPN3; Capn3; CAPN3; Capn3; CAPN3; CAPN3; 4931402G19Rik; CAPN3
UniSTS IDUniSTS:251621

Sequences

>Probe|12487864|PRIMERF Forward PCR primer (outermost) (24b)
GCTTCCTTTCCTTGAAGGTAGCTG
>Probe|12487864|PRIMERR Reverse PCR primer (outermost) (26b)
CTGCTCGAATGTCTTCTCTTTCACCC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map15 cmUniSTS:251621

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID251621
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5503378
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center