Display Settings:

Format

Send to:

Choose Destination
Pr012487186

STS probe AFMa275zc9 for angiomotin (AMOT) and 3 more genes

Synopsis

Field NameValues
NameAFMa275zc9
AliasesA275ZC9; RH63269; RH7786; W1242; stAFMa275zc9
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesAMOT; AMOT; AMOT; AMOT
UniSTS IDUniSTS:25101

Sequences

>Probe|12487186|PRIMERF Forward PCR primer (outermost) (22b)
CACTGGCTCTCTCACTAACTTG
>Probe|12487186|PRIMERR Reverse PCR primer (outermost) (20b)
AATTGCTTTTTGCCAATGTA

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmAFMa275zc9
Homo sapiensradiation hybridNCBI RHX561.2 crAFMA275ZC9
Homo sapiensradiation hybridWhitehead-RHX266.5 cr3000AFMA275ZC9

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID25101
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center