Display Settings:

Format

Send to:

Choose Destination
Pr012484462

STS probe RH1636 for FES proto-oncogene, tyrosine kinase (FES) and 1 more gene

Synopsis

Field NameValues
NameRH1636
AliasesRH44063; stSG28
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesFES; FURIN
UniSTS IDUniSTS:24856

Sequences

>Probe|12484462|PRIMERF Forward PCR primer (outermost) (22b)
CACTAAACTCCCAAAGTCCTGG
>Probe|12484462|PRIMERR Reverse PCR primer (outermost) (19b)
CTCCACCTTAGGCCTCAGC

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB415329.08 cr3000stSG28
Homo sapienslinkageRutgers Map15 cmRH1636
Homo sapiensradiation hybridNCBI RH15701.7 crstSG28

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID24856
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center