Display Settings:

Format

Send to:

Choose Destination
Pr012481286

STS probe G15877 for interferon induced protein with tetratricopeptide repeats 1 (IFIT1) and 3 more genes

Synopsis

Field NameValues
NameG15877
AliasesCHLC.UTR_00623_X03557; CHLC.UTR_00623_X03557.P37180
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesIFIT1; IFIT1; IFIT1; IFIT1
UniSTS IDUniSTS:24570

Sequences

>Probe|12481286|PRIMERF Forward PCR primer (outermost) (20b)
CACCCAGATATCAGCCACTT
>Probe|12481286|PRIMERR Reverse PCR primer (outermost) (25b)
ATAATGTTTCTGAAAACAGTAAGCA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map10 cmG15877

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID24570
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center