Display Settings:

Format

Send to:

Choose Destination
Pr012480620

STS probe AL010069 for CD58 molecule (CD58)

Synopsis

Field NameValues
NameAL010069
AliasSTSG33228FS
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target geneCD58
UniSTS IDUniSTS:24510

Sequences

>Probe|12480620|PRIMERF Forward PCR primer (outermost) (20b)
CACCAGGGAGAGAGAATGGA
>Probe|12480620|PRIMERR Reverse PCR primer (outermost) (19b)
GCCTCTCCAATTCCTCTGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map1 cmAL010069

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID24510
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center