Display Settings:

Format

Send to:

Choose Destination
Pr012475145

STS probe D14Mco14 for dopamine receptor D5 (Drd5) and 1 more gene

Synopsis

Field NameValues
NameD14Mco14
AliasD14Mco3
TypeSTS
Application
Source organism
Source sequence
Target genesDrd5; Drd5
UniSTS IDUniSTS:240168

Sequences

>Probe|12475145|PRIMERF Forward PCR primer (outermost) (20b)
TCCTTAGGCAAAATCTCACC
>Probe|12475145|PRIMERR Reverse PCR primer (outermost) (22b)
TATGCAGCAGACTACAGAAAGC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center