Display Settings:

Format

Send to:

Choose Destination
Pr012475092

Homo sapiens STS probe D6S1456

Synopsis

Field NameValues
NameD6S1456
AliasesHALD51D6; MR5224; RH37129; RH60747; RH6641; WI-3718; stSG6146
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:24012

Sequences

>Probe|12475092|PRIMERF Forward PCR primer (outermost) (20b)
CACACCTGGCCTTAATGCTT
>Probe|12475092|PRIMERR Reverse PCR primer (outermost) (25b)
GCAGAAAACATTAGGATTGTAAATG

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map6 cmD6S1456
Homo sapiensradiation hybridNCBI RH61631.6 crWI-3718
Homo sapiensradiation hybridWhitehead-RH6843.6 cr3000WI-3718

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID24012
Probe Cross-refcontext specific help for: Probe Cross-refGDB:588898
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center