Display Settings:

Format

Send to:

Choose Destination
Pr012473035

STS probe En2 for engrailed 2 (En2) and 1 more gene

Synopsis

Field NameValues
NameEn2
AliasUniSTS:238161
TypeSTS
Application
Source organism
Source sequence
Target genesEn2; En2
UniSTS IDUniSTS:238161

Sequences

>Probe|12473035|PRIMERF Forward PCR primer (outermost) (20b)
AGGCTCAAGGCTGAGTTTCA
>Probe|12473035|PRIMERR Reverse PCR primer (outermost) (20b)
CAGTCCCCTTTGCAGAAAAA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center