Display Settings:

Format

Send to:

Choose Destination
Pr012473012

STS probe Myh3 for myosin, heavy polypeptide 3, skeletal muscle, embryonic (Myh3)

Synopsis

Field NameValues
NameMyh3
TypeSTS
Application
Source organism
Source sequence
Target geneMyh3
UniSTS IDUniSTS:238140

Sequences

>Probe|12473012|PRIMERF Forward PCR primer (outermost) (26b)
GCAAAGACCCGTGACTTCACCTCTAG
>Probe|12473012|PRIMERR Reverse PCR primer (outermost) (23b)
GCATGTGGAAAAGTGATACGTGG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:2178583
UniSTS IDcontext specific help for: UniSTS ID238140
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center