Display Settings:

Format

Send to:

Choose Destination
Pr012472943

STS probe D7S2532 for histone deacetylase 9 (HDAC9) and 1 more gene

Synopsis

Field NameValues
NameD7S2532
AliasesAFM080yg1; sWSS2365
TypeSTS
Application
Source organism
Source sequence
Target genesHDAC9; HDAC9
UniSTS IDUniSTS:23775

Sequences

>Probe|12472943|PRIMERF Forward PCR primer (outermost) (18b)
CACAAAAGCACCTATTTC
>Probe|12472943|PRIMERR Reverse PCR primer (outermost) (20b)
CATCAAATCCATTTACCTTC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:3754494
UniSTS IDcontext specific help for: UniSTS ID23775
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center