Display Settings:

Format

Send to:

Choose Destination
Pr031802875

STS probe UniSTS:237639 for guanine nucleotide binding protein-like 1 (Gnl1)

Synopsis

Field NameValues
NameUniSTS:237639
TypeSTS
Application
Source organism
Source sequence
Target geneGnl1
UniSTS IDUniSTS:237639

Sequences

>Probe|31802875|PRIMERF Forward PCR primer (outermost) (20b)
TAATCCACAGGTCCCCAGAA
>Probe|31802875|PRIMERR Reverse PCR primer (outermost) (20b)
GTGTCACCACGGAAGCTTTT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID237639
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center