Display Settings:

Format

Send to:

Choose Destination
Pr031801323

STS probe UniSTS:235779 for apolipoprotein B receptor (Apobr) and 1 more gene

Synopsis

Field NameValues
NameUniSTS:235779
TypeSTS
Application
Source organism
Source sequence
Target genesApobr; Il27
UniSTS IDUniSTS:235779

Sequences

>Probe|31801323|PRIMERF Forward PCR primer (outermost) (20b)
CTAATAAAGCCATCCAGCCC
>Probe|31801323|PRIMERR Reverse PCR primer (outermost) (20b)
AAATGACGGCTCGGTATCAC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID235779
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center