Display Settings:

Format

Send to:

Choose Destination
Pr031800895

STS probe UniSTS:235319 for CDK2 (cyclin-dependent kinase 2)-associated protein 1 (Cdk2ap1) and 2 more genes

Synopsis

Field NameValues
NameUniSTS:235319
TypeSTS
Application
Source organism
Source sequence
Target genesCdk2ap1; Sbno1; LOC639202
UniSTS IDUniSTS:235319

Sequences

>Probe|31800895|PRIMERF Forward PCR primer (outermost) (20b)
GCTCCCAAGTGTCCAGAATG
>Probe|31800895|PRIMERR Reverse PCR primer (outermost) (20b)
GCAAATGAACCCTGCTCAGT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID235319
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center