Display Settings:

Format

Send to:

Choose Destination
Pr012472601

STS probe AL009855 for usherin (USH2A) and 3 more genes

Synopsis

Field NameValues
NameAL009855
AliasstSG32832FS
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesUSH2A; USH2A; USH2A; USH2A
UniSTS IDUniSTS:23467

Sequences

>Probe|12472601|PRIMERF Forward PCR primer (outermost) (22b)
CAATCATAACGAACTCATTCGG
>Probe|12472601|PRIMERR Reverse PCR primer (outermost) (22b)
TTGATAGAAAAGCTCTCGGAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map1 cmAL009855

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID23467
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center