Display Settings:

Format

Send to:

Choose Destination
Pr012471087

STS probe STS-U68019 for SMAD family member 3 (SMAD3) and 2 more genes

Synopsis

Field NameValues
NameSTS-U68019
AliasesRH75911; sts-U68019
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesSMAD3; SMAD3; SMAD3
UniSTS IDUniSTS:23276

Sequences

>Probe|12471087|PRIMERF Forward PCR primer (outermost) (20b)
CAAGTATGGTAGGGGAGGGC
>Probe|12471087|PRIMERR Reverse PCR primer (outermost) (18b)
CAGACGCCATTTCTTGCC

References

1.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB415231.16 cr3000sts-U68019
Homo sapienslinkageRutgers Map15 cmSTS-U68019

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID23276
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center