Display Settings:

Format

Send to:

Choose Destination
Pr012469168

STS probe UniSTS:231029 for WD repeat containing antisense to TP53 (WRAP53) and 5 more genes

Synopsis

Field NameValues
NameUniSTS:231029
AliasesMARC_3409-3410:991937215:1; MARC_3409-3410:966894317:1
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100458200; WRAP53; WRAP53; WRAP53; WRAP53; WRAP53
UniSTS IDUniSTS:231029

Sequences

>Probe|12469168|PRIMERF Forward PCR primer (outermost) (20b)
TTTCGCTCCTACAACCACCT
>Probe|12469168|PRIMERR Reverse PCR primer (outermost) (20b)
GCTGAAGGCTATGCAGGAGA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map17 cmUniSTS:231029

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID231029
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center