Display Settings:

Format

Send to:

Choose Destination
Pr012464592

Rattus norvegicus STS probe D18Rat103

Synopsis

Field NameValues
NameD18Rat103
AliasR0241-D02
TypeSTS
Application
Source organism
Source sequence
Target organismRattus norvegicus
UniSTS IDUniSTS:226909

Sequences

>Probe|12464592|PRIMERF Forward PCR primer (outermost) (20b)
GCCAATTGCTGCTTCAGATA
>Probe|12464592|PRIMERR Reverse PCR primer (outermost) (23b)
TGTCTTCTGAGAGCATGACTGTT

References

1.

A high-density integrated genetic linkage and radiation hybrid map of the laboratory rat.

Steen RG, Kwitek-Black AE, Glenn C, Gullings-Handley J, Van Etten W, Atkinson OS, Appel D, Twigger S, Muir M, Mull T, Granados M, Kissebah M, Russo K, Crane R, Popp M, Peden M, Matise T, Brown DM, Lu J, Kingsmore S, Tonellato PJ, Rozen S, Slonim D, Young P, Jacob HJ.

Genome Res. 1999 Jun;9(6):AP1-8, insert. Genome Res 1999 Aug;9(8):793.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Rattus norvegicuslinkageSHRSP X BN1811.5399 cmD18Rat103

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:41572
UniSTS IDcontext specific help for: UniSTS ID226909
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is temporarily unavailable.

Support Center