Display Settings:

Format

Send to:

Choose Destination
Pr031779333

STS probe UniSTS:224764 for myeloblastosis oncogene (Myb) and 1 more gene

Synopsis

Field NameValues
NameUniSTS:224764
TypeSTS
Application
Source organism
Source sequence
Target genesMyb; RGD1560020_predicted
UniSTS IDUniSTS:224764

Sequences

>Probe|31779333|PRIMERF Forward PCR primer (outermost) (20b)
AACCACACTTGCAGCTACCC
>Probe|31779333|PRIMERR Reverse PCR primer (outermost) (20b)
GCTGGTGAGGCACTTTCTTC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5507133
UniSTS IDcontext specific help for: UniSTS ID224764
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center