Display Settings:

Format

Send to:

Choose Destination
Pr012459796

STS probe D2S399 for xin actin binding repeat containing 2 (XIRP2) and 1 more gene

Synopsis

Field NameValues
NameD2S399
AliasesA131WB9; AFMa131wb9; HSA131WB9; RH4719; RH56924
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesXIRP2; XIRP2
UniSTS IDUniSTS:22148

Sequences

>Probe|12459796|PRIMERF Forward PCR primer (outermost) (20b)
CAAACATCCTACCTGCACAG
>Probe|12459796|PRIMERR Reverse PCR primer (outermost) (22b)
CTCAATGGGAAGTTATTGAATG

References

1.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

2.

A high-resolution recombination map of the human genome.

Kong A, Gudbjartsson DF, Sainz J, Jonsdottir GM, Gudjonsson SA, Richardsson B, Sigurdardottir S, Barnard J, Hallbeck B, Masson G, Shlien A, Palsson ST, Frigge ML, Thorgeirsson TE, Gulcher JR, Stefansson K.

Nat Genet. 2002 Jul;31(3):241-7.

Show All 4 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

4.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmD2S399
Homo sapienslinkageMarshfield2169.41 cmAFMa131wb9
Homo sapienslinkagedeCODE2171.79 cmD2S399
Homo sapienslinkageGenethon2174.8 cmAFMa131wb9
Homo sapiensradiation hybridWhitehead-RH2828.5 cr3000D2S399

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID22148
Probe Cross-refcontext specific help for: Probe Cross-refGDB:200121
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center