Display Settings:

Format

Send to:

Choose Destination
Pr012450403

Homo sapiens STS probe SHGC-14733

Synopsis

Field NameValues
NameSHGC-14733
AliasRH29832
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:21302

Sequences

>Probe|12450403|PRIMERF Forward PCR primer (outermost) (20b)
ATTGTGCAGGAGGAAACCAC
>Probe|12450403|PRIMERR Reverse PCR primer (outermost) (25b)
TTCATTCTGGAGAGAATTATCTTGG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3102925 cr10000SHGC-14733
Homo sapienslinkageRutgers Map10 cmSHGC-14733

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID21302
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center