Display Settings:

Format

Send to:

Choose Destination
Pr012449958

STS probe D14S1149 for neuronal PAS domain protein 3 (NPAS3) and 4 more genes

Synopsis

Field NameValues
NameD14S1149
AliasesRH101666; RH35133; SHGC-8229
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesNPAS3; NPAS3; NPAS3; NPAS3; NPAS3
UniSTS IDUniSTS:21262

Sequences

>Probe|12449958|PRIMERF Forward PCR primer (outermost) (21b)
ATTGGTCCCCATTTCTCAGAT
>Probe|12449958|PRIMERR Reverse PCR primer (outermost) (23b)
ATCGTATTTGGAGTCAGAACACC

References

1.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridTNG146854 cr50000SHGC-8229
Homo sapienslinkageRutgers Map14 cmD14S1149

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID21262
Probe Cross-refcontext specific help for: Probe Cross-refGDB:637966
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center