Display Settings:

Format

Send to:

Choose Destination
Pr012448462

STS probe RH127963 for beta-1,4-N-acetyl-galactosaminyltransferase 2 (B4GALNT2) and 11 more genes

Synopsis

Field NameValues
NameRH127963
AliasAA866323
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100524170; PHB; LOC100594013; LOC100596005; LOC100607355; PHB; PHB; B4GALNT2; PHB; LOC609045; LOC617249; LOC781100
UniSTS IDUniSTS:211273

Sequences

>Probe|12448462|PRIMERF Forward PCR primer (outermost) (22b)
AGGTAGGTGATGTTCCGAGAGC
>Probe|12448462|PRIMERR Reverse PCR primer (outermost) (22b)
CAGGAAGCAGAGAGAGCCAGAT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center