Display Settings:

Format

Send to:

Choose Destination
Pr012447402

STS probe RH136329 for APC, WNT signaling pathway regulator (Apc) and 1 more gene

Synopsis

Field NameValues
NameRH136329
TypeSTS
Application
Source organism
Source sequence
Target genesLOC100048863; Apc
UniSTS IDUniSTS:210319

Sequences

>Probe|12447402|PRIMERF Forward PCR primer (outermost) (20b)
TCTTGGGCCTTTATTGCTTG
>Probe|12447402|PRIMERR Reverse PCR primer (outermost) (20b)
CTATTCAGGAAGGCGCAAAC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID210319
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center