Display Settings:

Format

Send to:

Choose Destination
Pr012447301

STS probe RH136234 for acyl-Coenzyme A dehydrogenase, medium chain (Acadm)

Synopsis

Field NameValues
NameRH136234
TypeSTS
Application
Source organism
Source sequence
Target geneAcadm
UniSTS IDUniSTS:210228

Sequences

>Probe|12447301|PRIMERF Forward PCR primer (outermost) (20b)
CCTTTGTGCAAAACAAAGCA
>Probe|12447301|PRIMERR Reverse PCR primer (outermost) (20b)
TGGAAAAACACCCTGGACTT

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID210228
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center