Display Settings:

Format

Send to:

Choose Destination
Pr012446274

STS probe WI-12504 for EEF1A lysine methyltransferase 1 (EEF1AKMT1) and 3 more genes

Synopsis

Field NameValues
NameWI-12504
AliasesEST236348; RH21441
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesEEF1AKMT1; EEF1AKMT1; EEF1AKMT1; EEF1AKMT1
UniSTS IDUniSTS:20930

Sequences

>Probe|12446274|PRIMERF Forward PCR primer (outermost) (20b)
ATTCTCCCCAGAAATGAGGG
>Probe|12446274|PRIMERR Reverse PCR primer (outermost) (23b)
TAGATCCATCCCACTGACTTAGC

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB41346.53 cr3000WI-12504
Homo sapienslinkageRutgers Map13 cmWI-12504
Homo sapiensradiation hybridNCBI RH13106 crWI-12504

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID20930
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center