Display Settings:

Format

Send to:

Choose Destination
Pr012444218

STS probe D6S2036 for cyclin dependent kinase inhibitor 1A (CDKN1A) and 2 more genes

Synopsis

Field NameValues
NameD6S2036
AliasesSHGC-10190; STSG-10190
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCDKN1A; CDKN1A; CCND1
UniSTS IDUniSTS:20745

Sequences

>Probe|12444218|PRIMERF Forward PCR primer (outermost) (20b)
ATTCAGCATTGTGGGAGGAG
>Probe|12444218|PRIMERR Reverse PCR primer (outermost) (20b)
TGGACTGTTTTCTCTCGGCT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map6 cmD6S2036

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID20745
Probe Cross-refcontext specific help for: Probe Cross-refGDB:735097
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center