Display Settings:

Format

Send to:

Choose Destination
Pr012443430

STS probe A109YC1 for myosin IIIB (MYO3B) and 1 more gene

Synopsis

Field NameValues
NameA109YC1
AliasesAFMA109YC1; W5362
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesMYO3B; MYO3B
UniSTS IDUniSTS:20674

Sequences

>Probe|12443430|PRIMERF Forward PCR primer (outermost) (25b)
ATTATTGCTACAAACACCAAAAGAG
>Probe|12443430|PRIMERR Reverse PCR primer (outermost) (16b)
GGGAAAACCTGCCTGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmA109YC1

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID20674
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center