Display Settings:

Format

Send to:

Choose Destination
Pr012439836

STS probe DXS7508 for interleukin 1 receptor accessory protein like 1 (IL1RAPL1) and 2 more genes

Synopsis

Field NameValues
NameDXS7508
AliasesMR12800; WI-9922
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesIL1RAPL1; IL1RAPL1; IL1RAPL1
UniSTS IDUniSTS:20350

Sequences

>Probe|12439836|PRIMERF Forward PCR primer (outermost) (20b)
ATGTTGAAGCCCAGAACGTC
>Probe|12439836|PRIMERR Reverse PCR primer (outermost) (20b)
AATGCACAAAGGTCGGTTTC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmDXS7508

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID20350
Probe Cross-refcontext specific help for: Probe Cross-refGDB:588688
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center