Display Settings:

Format

Send to:

Choose Destination
Pr012439391

STS probe L77312 for immunoglobulin heavy locus (IGH)

Synopsis

Field NameValues
NameL77312
AliasHUMSWX3022
TypeSTS
Application
Source organism
Source sequence
Target geneIGH
UniSTS IDUniSTS:2031

Sequences

>Probe|12439391|PRIMERF Forward PCR primer (outermost) (24b)
AAATGAACCAAATATCAGGAAAGG
>Probe|12439391|PRIMERR Reverse PCR primer (outermost) (24b)
CTTATGAGAATTGTGTGCTTTAAC

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID2031
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center