Display Settings:

Format

Send to:

Choose Destination
Pr012438062

STS probe UniSTS:201903 for RAP2B, member of RAS oncogene family (RAP2B) and 22 more genes

Synopsis

Field NameValues
NameUniSTS:201903
Aliasfl05f09.x1
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesrap2ab; RAP2B; RAP2B; LOC100149736; RAP2B; RAP2B; LOC100392358; RAP2B; RAP2B; RAP2B; rap2b; rap2a; RAP2B; Rap2bMore
UniSTS IDUniSTS:201903

Sequences

>Probe|12438062|PRIMERF Forward PCR primer (outermost) (22b)
TGATGTCCTGGAAGCTCTGCTG
>Probe|12438062|PRIMERR Reverse PCR primer (outermost) (22b)
CTTCATCGAGAAGTACGACCCG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map3 cmUniSTS:201903

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID201903
Probe Cross-refcontext specific help for: Probe Cross-refRGD:5507033
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center