Display Settings:

Format

Send to:

Choose Destination
Pr012437547

STS probe D6S311 for SAM and SH3 domain containing 1 (SASH1) and 5 more genes

Synopsis

Field NameValues
NameD6S311
Aliases276XF1; AFM276xf1; HS276XF1; RH13137; RH15381; RH60527; RH6503; stSG6979
TypeSTS
Application
Source organism
Source sequence
Target organismsMacaca mulatta; Homo sapiens
Target genesSASH1; SASH1; SASH1; SASH1; SASH1; SASH1
UniSTS IDUniSTS:20144

Sequences

>Probe|12437547|PRIMERF Forward PCR primer (outermost) (20b)
ATGTCCTCATTGGTGTTGTG
>Probe|12437547|PRIMERR Reverse PCR primer (outermost) (20b)
GATTCAGAGCCCAGGAAGAT

References

1.

A rhesus macaque radiation hybrid map and comparative analysis with the human genome.

Murphy WJ, Agarwala R, Schäffer AA, Stephens R, Smith C Jr, Crumpler NJ, David VA, O'Brien SJ.

Genomics. 2005 Oct;86(4):383-95.

2.

Comprehensive human genetic maps: individual and sex-specific variation in recombination.

Broman KW, Murray JC, Sheffield VC, White RL, Weber JL.

Am J Hum Genet. 1998 Sep;63(3):861-9.

Show All 5 References...

3.

A comprehensive genetic map of the human genome based on 5,264 microsatellites.

Dib C, Fauré S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, Marc S, Hazan J, Seboun E, Lathrop M, Gyapay G, Morissette J, Weissenbach J.

Nature. 1996 Mar 14;380(6570):152-4.

4.

An STS-based map of the human genome.

Hudson TJ, Stein LD, Gerety SS, Ma J, Castle AB, Silva J, Slonim DK, Baptista R, Kruglyak L, Xu SH, Hu X, Colbert AM, Rosenberg C, Reeve-Daly MP, Rozen S, Hui L, Wu X, Vestergaard C, Wilson KM, Bae JS, Maitra S, Ganiatsas S, Evans CA, DeAngelis MM, Ingalls KA, Nahf RW, Horton LT Jr, Anderson MO, Collymore AJ, Ye W, Kouyoumjian V, Zemsteva IS, Tam J, Devine R, Courtney DF, Renaud MT, Nguyen H, O'Connor TJ, Fizames C, Fauré S, Gyapay G, Dib C, Morissette J, Orlin JB, Birren BW, Goodman N, Weissenbach J, Hawkins TL, Foote S, Page DC, Lander ES.

Science. 1995 Dec 22;270(5244):1945-54.

5.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB46593.14 cr3000AFM276xf1
Macaca mulattaradiation hybridRH4155.4 crD6S311
Homo sapienslinkageMarshfield6147.13 cmAFM276xf1
Homo sapienslinkageGenethon6148.2 cmAFM276xf1
Homo sapiensradiation hybridWhitehead-RH6808.2 cr3000D6S311

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refGDB:188611
UniSTS IDcontext specific help for: UniSTS ID20144
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center