Display Settings:

Format

Send to:

Choose Destination
Pr012435600

STS probe G16531 for protein tyrosine phosphatase, non-receptor type 23 (PTPN23) and 7 more genes

Synopsis

Field NameValues
NameG16531
AliasSHGC-3285
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100287401; LOC100289769; LOC100291594; PTPN23; PTPN23; PTPN23; PTPN23; PTPN23
UniSTS IDUniSTS:19969

Sequences

>Probe|12435600|PRIMERF Forward PCR primer (outermost) (25b)
ATGGTCTAATATGGAAAGAACATGG
>Probe|12435600|PRIMERR Reverse PCR primer (outermost) (25b)
AGATGAGGAAATGAGGAAACTGAGG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map3 cmG16531

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID19969
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center