Display Settings:

Format

Send to:

Choose Destination
Pr012429959

STS probe SHGC-57821 for angiotensin I converting enzyme (ACE) and 1 more gene

Synopsis

Field NameValues
NameSHGC-57821
AliasRH81925
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100453403; ACE
UniSTS IDUniSTS:19461

Sequences

>Probe|12429959|PRIMERF Forward PCR primer (outermost) (20b)
ATGCAGGGAGTGAGGAGGTG
>Probe|12429959|PRIMERR Reverse PCR primer (outermost) (20b)
GCCTCAGACGCTGGAGTGTA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map17 cmSHGC-57821

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID19461
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center