Display Settings:

Format

Send to:

Choose Destination
Pr012425727

STS probe HUM0C12G05 for eukaryotic translation initiation factor 2 subunit alpha (EIF2S1) and 6 more genes

Synopsis

Field NameValues
NameHUM0C12G05
AliasesRH1360; RH95514; SHGC-2558
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesEIF2S1; EIF2S1; EIF2S1; EIF2S1; EIF2S1; PLEK2; EIF2S1
UniSTS IDUniSTS:19080

Sequences

>Probe|12425727|PRIMERF Forward PCR primer (outermost) (24b)
ATGAAATGCCCTCCTAAATGTCAG
>Probe|12425727|PRIMERR Reverse PCR primer (outermost) (25b)
AGAAAGATTGGGATTGTTTGCCTTG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 4 References...

3.

A high-resolution radiation hybrid map of the human genome draft sequence.

Olivier M, Aggarwal A, Allen J, Almendras AA, Bajorek ES, Beasley EM, Brady SD, Bushard JM, Bustos VI, Chu A, Chung TR, De Witte A, Denys ME, Dominguez R, Fang NY, Foster BD, Freudenberg RW, Hadley D, Hamilton LR, Jeffrey TJ, Kelly L, Lazzeroni L, Levy MR, Lewis SC, Liu X, Lopez FJ, Louie B, Marquis JP, Martinez RA, Matsuura MK, Misherghi NS, Norton JA, Olshen A, Perkins SM, Perou AJ, Piercy C, Piercy M, Qin F, Reif T, Sheppard K, Shokoohi V, Smick GA, Sun WL, Stewart EA, Fernando J, Tejeda, Tran NM, Trejo T, Vo NT, Yan SC, Zierten DL, Zhao S, Sachidanandam R, Trask BJ, Myers RM, Cox DR.

Science. 2001 Feb 16;291(5507):1298-302.

4.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3142354 cr10000SHGC-2558
Homo sapiensradiation hybridGeneMap99-G3142402 cr10000SHGC-2558
Homo sapiensradiation hybridTNG1422719 cr50000SHGC-2558
Homo sapienslinkageRutgers Map14 cmHUM0C12G05
Homo sapiensradiation hybridNCBI RH14657.3 crSHGC-2558

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID19080
Probe Cross-refcontext specific help for: Probe Cross-refGDB:214387; GDB:223825
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center