Display Settings:

Format

Send to:

Choose Destination
Pr012423360

STS probe STS-U09412 for zinc finger protein 134 (ZNF134) and 6 more genes

Synopsis

Field NameValues
NameSTS-U09412
AliasesRH39177; sts-U09412
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100288641; LOC100291669; ZNF530; ZNF211; ZNF134; ZNF211; ZNF134
UniSTS IDUniSTS:18867

Sequences

>Probe|12423360|PRIMERF Forward PCR primer (outermost) (21b)
ATCTGAACATTGACACAAAGG
>Probe|12423360|PRIMERR Reverse PCR primer (outermost) (22b)
TGGATTGACAGTGACATAACTC

References

1.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

2.

A physical map of 30,000 human genes.

Deloukas P, Schuler GD, Gyapay G, Beasley EM, Soderlund C, Rodriguez-Tomé P, Hui L, Matise TC, McKusick KB, Beckmann JS, Bentolila S, Bihoreau M, Birren BB, Browne J, Butler A, Castle AB, Chiannilkulchai N, Clee C, Day PJ, Dehejia A, Dibling T, Drouot N, Duprat S, Fizames C, Fox S, Gelling S, Green L, Harrison P, Hocking R, Holloway E, Hunt S, Keil S, Lijnzaad P, Louis-Dit-Sully C, Ma J, Mendis A, Miller J, Morissette J, Muselet D, Nusbaum HC, Peck A, Rozen S, Simon D, Slonim DK, Staples R, Stein LD, Stewart EA, Suchard MA, Thangarajah T, Vega-Czarny N, Webber C, Wu X, Hudson J, Auffray C, Nomura N, Sikela JM, Polymeropoulos MH, James MR, Lander ES, Hudson TJ, Myers RM, Cox DR, Weissenbach J, Boguski MS, Bentley DR.

Science. 1998 Oct 23;282(5389):744-6.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridGeneMap99-GB419287.74 cr3000sts-U09412
Homo sapienslinkageRutgers Map19 cmSTS-U09412
Homo sapiensradiation hybridNCBI RH19600.5 crsts-U09412

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID18867
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center