Display Settings:

Format

Send to:

Choose Destination
Pr012421064

STS probe UniSTS:186600 for angio associated migratory cell protein (AAMP) and 20 more genes

Synopsis

Field NameValues
NameUniSTS:186600
Alias337G113'
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesAAMP; PNKD; AAMP; PNKD; PNKD; AAMP; ARPC2; AAMP; LOC100599615; AAMP; LOC100621513; LOC100664434; AAMP; AAMPMore
UniSTS IDUniSTS:186600

Sequences

>Probe|12421064|PRIMERF Forward PCR primer (outermost) (20b)
GATTATCGAGGTGGTAGAAC
>Probe|12421064|PRIMERR Reverse PCR primer (outermost) (20b)
CAGGCCTGAGAACTAAGTGT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmUniSTS:186600

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID186600
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center