Display Settings:

Format

Send to:

Choose Destination
Pr012420779

STS probe Clpx

Synopsis

Field NameValues
NameClpx
TypeSTS
Application
Source organism
Source sequence
UniSTS IDUniSTS:186343

Sequences

>Probe|12420779|PRIMERF Forward PCR primer (outermost) (23b)
TTCTGGCTCTCATGCCTGCAAGT
>Probe|12420779|PRIMERR Reverse PCR primer (outermost) (30b)
TTAGATTTTGCTTTCCTTTGTTTTTTGATA

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
Probe Cross-refcontext specific help for: Probe Cross-refMGI:1926382
UniSTS IDcontext specific help for: UniSTS ID186343
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center