Display Settings:

Format

Send to:

Choose Destination
Pr012420499

STS probe BB120594 for mitogen-activated protein kinase 8 interacting protein 3 (Mapk8ip3)

Synopsis

Field NameValues
NameBB120594
Alias1119739
TypeSTS
Application
Source organism
Source sequence
Target geneMapk8ip3
UniSTS IDUniSTS:186090

Sequences

>Probe|12420499|PRIMERF Forward PCR primer (outermost) (20b)
TTCCTCGACCTTCACAACAG
>Probe|12420499|PRIMERR Reverse PCR primer (outermost) (20b)
GACTCTAAGGAGGTGCCCTG

References

No Reference Data.

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID186090
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center