Display Settings:

Format

Send to:

Choose Destination
Pr012419869

STS probe AF043276 for opioid receptor-like 1 (Oprl1)

Synopsis

Field NameValues
NameAF043276
AliasND
TypeSTS
Application
Source organism
Source sequence
Target organismMus musculus
Target geneOprl1
UniSTS IDUniSTS:185523

Sequences

>Probe|12419869|PRIMERF Forward PCR primer (outermost) (20b)
TTTGAGCAATCTGCAAGGAC
>Probe|12419869|PRIMERR Reverse PCR primer (outermost) (20b)
CTGACCCATAGAAAGGGCAT

References

1.

A radiation hybrid map of mouse genes.

Hudson TJ, Church DM, Greenaway S, Nguyen H, Cook A, Steen RG, Van Etten WJ, Castle AB, Strivens MA, Trickett P, Heuston C, Davison C, Southwell A, Hardisty R, Varela-Carver A, Haynes AR, Rodriguez-Tome P, Doi H, Ko MS, Pontius J, Schriml L, Wagner L, Maglott D, Brown SD, Lander ES, Schuler G, Denny P.

Nat Genet. 2001 Oct;29(2):201-5.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Mus musculusradiation hybridWI/MRC-RH22027.27 crAF043276

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID185523
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center