Display Settings:

Format

Send to:

Choose Destination
Pr012419120

STS probe SHGC-36554 for NEDD4 binding protein 2 like 2 (N4BP2L2) and 3 more genes

Synopsis

Field NameValues
NameSHGC-36554
AliasRH37997
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesN4BP2L2; N4BP2L2; N4BP2L2; N4BP2L2
UniSTS IDUniSTS:18485

Sequences

>Probe|12419120|PRIMERF Forward PCR primer (outermost) (25b)
ATCCAGTGAGAGAAATATAATTTGC
>Probe|12419120|PRIMERR Reverse PCR primer (outermost) (22b)
TTTGGACAGTTGCTTAACATGG

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Show All 3 References...

3.

A fast and scalable radiation hybrid map construction and integration strategy.

Agarwala R, Applegate DL, Maglott D, Schuler GD, Schäffer AA.

Genome Res. 2000 Mar;10(3):350-64.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G313671 cr10000SHGC-36554
Homo sapiensradiation hybridGeneMap99-G313667 cr10000SHGC-36554
Homo sapienslinkageRutgers Map13 cmSHGC-36554
Homo sapiensradiation hybridNCBI RH13283.4 crSHGC-36554

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID18485
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center