Display Settings:

Format

Send to:

Choose Destination
Pr012416755

STS probe SHGC-36560 for protein kinase, cGMP-dependent, type I (PRKG1) and 2 more genes

Synopsis

Field NameValues
NameSHGC-36560
AliasRH38031
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPRKG1; PRKG1; PRKG1
UniSTS IDUniSTS:18272

Sequences

>Probe|12416755|PRIMERF Forward PCR primer (outermost) (24b)
ATCAGATTATTTTCCTCTTCAGGC
>Probe|12416755|PRIMERR Reverse PCR primer (outermost) (25b)
TCAGACTTATTTAATGTCCTACCGA

References

1.

A physical map of human chromosome 7: an integrated YAC contig map with average STS spacing of 79 kb.

Bouffard GG, Idol JR, Braden VV, Iyer LM, Cunningham AF, Weintraub LA, Touchman JW, Mohr-Tidwell RM, Peluso DC, Fulton RS, Ueltzen MS, Weissenbach J, Magness CL, Green ED.

Genome Res. 1997 Jul;7(7):673-92.

2.

An STS-based radiation hybrid map of the human genome.

Stewart EA, McKusick KB, Aggarwal A, Bajorek E, Brady S, Chu A, Fang N, Hadley D, Harris M, Hussain S, Lee R, Maratukulam A, O'Connor K, Perkins S, Piercy M, Qin F, Reif T, Sanders C, She X, Sun WL, Tabar P, Voyticky S, Cowles S, Fan JB, Mader C, Quackenbush J, Myers RM, Cox DR.

Genome Res. 1997 May;7(5):422-33.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapiensradiation hybridStanford-G3102365 cr10000SHGC-36560
Homo sapiensradiation hybridGeneMap99-G3102341 cr10000SHGC-36560
Homo sapienslinkageRutgers Map10 cmSHGC-36560

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID18272
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center