Display Settings:

Format

Send to:

Choose Destination
Pr012415789

STS probe G31190 for kinesin family member 1A (KIF1A) and 3 more genes

Synopsis

Field NameValues
NameG31190
AliasUC-68
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesLOC100451678; KIF1A; KIF1A; LOC748500
UniSTS IDUniSTS:181850

Sequences

>Probe|12415789|PRIMERF Forward PCR primer (outermost) (24b)
AAGGCTGTCATTGTCCACATCCTG
>Probe|12415789|PRIMERR Reverse PCR primer (outermost) (24b)
TCCAAACCGTATCAGTATCTTGGA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map2 cmG31190

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID181850
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center