Display Settings:

Format

Send to:

Choose Destination
Pr012415749

Homo sapiens STS probe stSG72959

Synopsis

Field NameValues
NamestSG72959
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:181814

Sequences

>Probe|12415749|PRIMERF Forward PCR primer (outermost) (20b)
CAAGAGGACAAATCCAGGGA
>Probe|12415749|PRIMERR Reverse PCR primer (outermost) (21b)
TGATGGAAGAGAGATCCCATG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map10 cmstSG72959

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID181814
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center