Display Settings:

Format

Send to:

Choose Destination
Pr012415727

STS probe stSG68095 for pleckstrin homology domain containing S1 (PLEKHS1) and 3 more genes

Synopsis

Field NameValues
NamestSG68095
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPLEKHS1; PLEKHS1; PLEKHS1; PLEKHS1
UniSTS IDUniSTS:181795

Sequences

>Probe|12415727|PRIMERF Forward PCR primer (outermost) (18b)
TTCCTCCACAGCCGAGAC
>Probe|12415727|PRIMERR Reverse PCR primer (outermost) (20b)
CAGCCAAATCTTTGCTCACA

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map10 cmstSG68095

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID181795
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center