Display Settings:

Format

Send to:

Choose Destination
Pr012415693

Homo sapiens STS probe stFSX369

Synopsis

Field NameValues
NamestFSX369
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
UniSTS IDUniSTS:181764

Sequences

>Probe|12415693|PRIMERF Forward PCR primer (outermost) (20b)
CTTCAGTGACCCAGGGAAAA
>Probe|12415693|PRIMERR Reverse PCR primer (outermost) (22b)
ATTGGCTTTAGTGTCCTTCTGC

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers MapX cmstFSX369

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID181764
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center