Display Settings:

Format

Send to:

Choose Destination
Pr012415679

STS probe D16S472E for chromodomain helicase DNA binding protein 9 (CHD9) and 6 more genes

Synopsis

Field NameValues
NameD16S472E
AliasEST01954
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesCHD9; CHD9; CHD9; LOC100596749; CHD9; CHD9; CHD9
UniSTS IDUniSTS:181751

Sequences

>Probe|12415679|PRIMERF Forward PCR primer (outermost) (18b)
TTGCCTGAAACACTGGTG
>Probe|12415679|PRIMERR Reverse PCR primer (outermost) (20b)
GTATTCTCACTGGTCCCGTT

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map16 cmD16S472E

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID181751
Probe Cross-refcontext specific help for: Probe Cross-refGDB:198988
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center