Display Settings:

Format

Send to:

Choose Destination
Pr012415671

STS probe stdJ646G2SP6 for protein phosphatase 4 regulatory subunit 1 like (pseudogene) (PPP4R1L) and 7 more genes

Synopsis

Field NameValues
NamestdJ646G2SP6
TypeSTS
Application
Source organism
Source sequence
Target organismHomo sapiens
Target genesPPP4R1L; LOC100413665; LOC100474691; LOC100602732; PPP4R1L; PPP4R1; LOC783163; LOC790153
UniSTS IDUniSTS:181744

Sequences

>Probe|12415671|PRIMERF Forward PCR primer (outermost) (20b)
TTCAGAGAGCACCACTGGAA
>Probe|12415671|PRIMERR Reverse PCR primer (outermost) (19b)
AGTGCGGACTGAGCTGATG

References

No Reference Data.

Genetic maps for probe

OrganismMap TypeMap NameChromosomePositionMarker NameStatus
Homo sapienslinkageRutgers Map20 cmstdJ646G2SP6

Computational maps for probe

Analysis is pending.

Additional Data

Field NameValues
UniSTS IDcontext specific help for: UniSTS ID181744
Download UniSTS epcr legacy dataDownload NCBI UniSTS data

Supplemental Content

Search details

See more...

Recent activity

Your browsing activity is empty.

Activity recording is turned off.

Turn recording back on

See more...
Support Center